Searches in the tandem repeats database: BLAST primers

If you have several primer pairs to submit, use this page

Input sequences (Fasta format or bare sequences):

left primer (test : GAGAAACAGGAGGGCGTTG):

right primer (test : TATTACGACGACCGCTATGC) :

Blast in:

Whole sequence Only Tandem Repeats (and flanking sequences)

Select genomes to search :

(For the given primers, select Mycobacterium tuberculosis strains)

Choose a kingdom


Choose one or more genomes :


 

Link to the main Blast Page