IGM

Searches in the tandem repeats database

Search matches between PCR primers and target genomes

Input primers sequences (format in the exemple below):

Input format:

name left_primer right_primer
(exemples taken from Mycobacterium tuberculosis) :
name1 GAGAAACAGGAGGGCGTTG TATTACGACGACCGCTATGC
name2 CGTGCACAGTTGGGTGTTTA TTCGTTCAGGAACTCCAAGG

list of primer pairs:

 Search in:  Whole sequences    Only Tandem Repeats (and flanking sequences)

Select one or more target genomes:

Choose a kingdom

Choose one or more genomes :


Link to the main Blast Page