60 minisatellites studied on chromosome 21:
Click on a minisatellite name to view allele size and frequency data

Repeat name

dbSNP ss#

Physical position (kb)

Unit length

Copy number

Total length

Percent matches

Sequence

Associated gene

left primer

right primer

PCR conditions (AT)

nbr of typed strains

nbr of alleles

Polymorphism index

Copy number range

Estimation mode

CEB256

6313628

220

26

49

1277

85%

Alignment

CAACCTCCACCTCCCAGAAAAAGAAAG

CGTGCTGTGGACGTATTAACTTACTGGAAA

68°C

28

3

0.566

900-1450 bp

1

CEB255

3948

38

25

962

83%

Alignment

CTGGAACCCTGACAATTTTCAAGTGAGG

TTTTTGTTGCTGGAACCCTGACAATTTA

55°C

28

1

0

1050 bp

1

CEB258

 

4445

22

29

633

91%

Alignment

ACATAACAATCAAAGCAGAGCCTCACTGAC

TACATTTTCTGACTTCTGTGGTCTTCATGG

59°C

28

1

0

720 bp

1

CEB259

 

6028

26

97

2523

73%

Alignment

ATCATTTGTGTTGCCACAGAAGAATAACTG

ACAGAACCAAAAGCCAAATAAACCTCATGT

failed

28

failed

failed

failed

1

CEB260

 

7748

73

10

748

93%

Alignment

GATGTAGTTGCATTGCTTGAGTGCATTAAC

ATCGCCAAGTCATAAAGGTGTACTGTGGT

64°C

28

1

0

891 bp

1

CEB261

6313629

10501

25

15

370

82%

Alignment

NCAM2

TGCAAAATCTCTCCCTCTCTGTTGATAAAA

GCTTATGTATGAGGCAGCAAATAGGATCAG

63°C

28

4

0.703

490-550 bp

1

CEB263

 

19963

29

28

811

71%

Alignment

TTTTAAATTCTGATTTTCTTGCGAAGGTGA

CTTGCAGTATGAGGTCCTCTGTATCTGGTC

68°C

28

1

0

917 bp

1

CEB264

 

21556

30

32

959

79%

Alignment

GCACTTTTGTCCCCATGTGTCATTCTAAC

AACACACAGAGAGCCGCAGCAGAGAC

68°C

28

2

0.142

830-880 bp

1

CEB262

 

19540

30

16

481

85%

Alignment

TGACTTCAAAGAGTTTGTATTGTCACATCA

AATCGAAAGCTACTGTGGTTTGCTCATTTT

failed

28

failed

failed

failed

1

CEB267

 

25371

24

18

419

90%

Alignment

CHAF1B

TGAGAGGTCACACCTGTGAAGTAAGAATAGT

TATAAACATCAAGCATTTGCCAGACATGG

failed

28

failed

failed

failed

1

CEB265

6313630

23006

54

13

680

74%

Alignment

CATACAGATACGGATGATTCTTGCTCTTGG

TCTATCTTATTTGACCTCTGCCCGTAGTCC

68°C

28

2

0.142

830-880 bp

1

CEB234

6313631

23639

30

13

396

82%

Alignment

CGAGGTGCCCCAAGGAGGGGAGGAG

GAGAGGCTGCCGTCCCCCGATTGCT

68°C

28

2

0.356

610-640 bp

1

CEB266

6313632

24912

45

13

565

72%

Alignment

GCACCAACCAGATAGGCCACTGAGAT

ATTTCTCTGGGTATTTTTCATCTGGAAGCA

68°C

28

2

0.356

821-866 bp

1

CEB215

22291

28

97

2705

87%

Alignment

GAGCAAGACTCCGATTCGAACAATG

TGAGATAAAATAAGGAATCAAATACTTCGTTG

failed

28

failed

failed

failed

1

CEB257

 

29529

18

25

446

75%

Alignment

CAGGTAGTATTATCATTGATCTGGTGGAAC

CTCTGCTCTCACTCTGCCTCCCTTCT

failed

28

failed

failed

failed

1

CEB236

 

30516

23

28

639

74%

Alignment

TGCATTTTCTTCTAGGGGAGTATGACAAGT

CTACTTGGGATGCTGAGGCAGGATTATG

68°C

28

1

0

900 bp

1

CEB271

 

30440

20

104

2084

75%

Alignment

TMPRSS2

ACTCCTTGAGTCTTGGAGGGACTGACAC

ACTCATCTCCTGGTGGAGAAGACACTCAC

57°C

28

10

0.832

1100-2900 bp

1

CEB270

6313634

30145

22

24

518

83%

Alignment

hypothetical gene

CTTGAGGAGGACTGAGCCTTCAGAAGTTAG

TAAACTAGATGAAAGAGTTGCTGCGCCTGA

68°C

28

2

0.392

642-690 bp

1

CEB235

 

29314

39

17

665

90%

Alignment

DSCAM

GCTTTCAGTGGCTCTGGAGGTTTTAGTAAG

AATAGCGAAGAGGATGTTCCCAAACAAAAT

68°C

28

2

0.041

1500-1850 bp

1

CEB268

6313633

26682

22

17

383

72%

Alignment

KCNJ6

GGAAAGTGACAGCTCCCTGTTTGAATTAT

AAGACATAAGTGCTCCAGGTGTTAACAGGA

68°C

28

6

0.636

500-690 bp

1

CEB269

 

28940

74

14

1021

97%

Alignment

CTGGAGGCCAGAAGTTCAAAATCAAGTT

TATCCAAGTGGGCTCTAGATCCAGTGATAC

68°C

28

14

0.876

1600-4500 bp

1

CEB272

6313635

30670

34

12

410

98%

Alignment

AATTGTTGAGGAGACTTCATATTGCTTTCC

GACATCCAAAAGGCCAATGAGTATATGAAA

59°C

28

2

0.471

600-640 bp

1

CEB273

 

30771

28

14

379

80%

Alignment

CAGCTTGGGCAATGGAGTGAGACTGTCT

ACTGCACTCCAGCCTCTCCCATCCCTA

68°C

28

1

0

580 bp

1

CEB239

6313639

31675

37

12

446

93%

Alignment

PDE9A

GAGACAGTATCAGACACACCAGACAAAAGC

CTGTACCCGGTTAGATCCACACCCTATG

68°C

28

3

0.564

650-850 bp

1

CEB278

6313640

31833

31

30

921

83%

Alignment

WDR4

CTGAACGAATTAAGTGATGTACCCAGAAGC

GGAATGTTTAGCAGCAACCGAATATACCAG

64°C

28

4

0.693

810-1200 bp

1

CEB274

6313636

30829

29

36

1045

77%

Alignment

AAAGAGCCAAGTGAAGTCCCTTCTCTGAA

CTTCTTGGGAACATCCATGGCTCAG

68°C

28

8

0.6

660-1420 bp

1

CEB275

 

31147

34

37

1284

77%

Alignment

AAACAAAGAGTCCAGGAGACGCCTGAGAGA

AATCTGCTCTTTGCCTCCATTCCTCAT

68°C

28

1

0

1510 bp

1

CEB276

6313637

31252

22

35

769

78%

Alignment

ABCG1

GGGTTCTGGTCTGCAGTTTTTATCTGAGTT

AGGTTCAGTATTTGAAACAGCCAGATGGTA

68°C

28

2

0.191

840-870 bp

1

CEB237

6313638

31420

44

19

752

81%

Alignment

UBASH3A

ATGGAATCCAGAGAAGCAAGTTACACCAAT

CAGTATTCTCACCACTGCACTCAGCAAGT

68°C

28

2

0.293

910-955 bp

1

CEB238

 

31572

51

59

3015

94%

Alignment

GAGTAGCCACAGGACAGAACTGAGAAGC

CCTGAAGAGAAGACAAGGAGAAAGGATGAC

68°C

28

7

0.789

830-3000 bp

1

CEB240

6313641

32177

17

53

883

80%

Alignment

AGGTGTACCAGTACAGCAGCTTTGGACCTA

GTTTGTCTCCTCTTGCCCTCTGGAAAGTAA

68°C

28

3

0.513

900-1060 bp

1

CEB277

 

31619

114

14

1603

78%

Alignment

TGTAATAATTCATCCACCCAGATTTGTATGC

ATCTTAAATGGGCAGGTTAATGGATTGATG

57°C

28

1

0

1650 bp

1

CEB291

 

34854

28

22

602

85%

Alignment

ACAGCTCAAAGTGCGAGACAGGAACAC

GGAGGCCCCTCACAGGGAGTAGATA

68°C

28

10

0.870

800-1300 bp

1

CEB248

6313654

34384

36

37

1339

70%

Alignment

COL18A1

CCTGTACATAGTGAAGGTGGGTTCTATTGC

GTAAACCCAACATCGAGAAAACAAGGATGG

68°C

28

5

0.636

830-1800 bp

1

CEB286

6313655

34390

18

34

609

82%

Alignment

COL18A1

ACTTCCTCCACTCCTGGACATCGTAGTCTC

CAAGACCCAGCTGTCCTCCAGGAAT

64°C

28

5

0.660

565-850 bp

1

CEB287

6313656

34454

44

10

448

77%

Alignment

COL18A1

ATCCTAACTTTCAGGGGCTTTGGTCCT

AGCTGGAAGAAAGCAGCAGGGTCAC

68°C

28

3

0.513

430-570 bp

1

CEB288

6313657

34474

66

11

694

86%

Alignment

SLC19A1

AATTAGAAGAGCAGTGAAACCACAGAGTCG

AAGACTAGTTTCTTTGCAGAGCACCAGAAG

68°C

28

3

0.551

690-822 bp

1

CEB249

6313658

34683

51

22

1132

88%

Alignment

TTTTTGCTTTCCGTAAGATAACAATTTTCC

AAGCGAAGAGAGTGTGTGTGACAGTGACTA

68°C

28

2

0.499

1300-1350 bp

1

CEB290

6313659

34830

52

12

627

91%

Alignment

LOC115381:

GATACTTCTCCAGCAGGGGAAACAAGAAGT

CTGAGCAGGGACAGAGGCTCTCATCT

68°C

28

4

0.640

670-920 bp

1

CEB246

6313652

33920

43

12

496

87%

Alignment

hypothetical gene

GATGCTGACTCACGTGGCTTCTCTGT

ATCATTTTAGATCCATGACTCCCCTTGGA

68°C

28

5

0.659

600-1350 bp

1

CEB250

6313660

34932

23

32

744

94%

Alignment

COL6A1

CTTTGAGGTGAGTGGTGACTCCTGCTC

CAGCAGCTAATTCTAACGTTTAAGGTCATCC

68°C

28

19

0.930

540-1850 bp

1

CEB292

6313661

34950

33

17

552

91%

Alignment

GGGACCCTGCATTTCCGTTTCAGGT

GAATCCCATGAGGCAGCTGAGAGAG

60°C

28

5

0.546

575-1100 bp

1

CEB251

6313662

34992

39

40

1575

88%

Alignment

GGTGACAAAGTGCCAGTCAGTGATTGTAT

AATCATCTCTGGGGAGGTGCCGTTTACATA

68°C

28

3

0.393

1740-1960 bp

1

CEB252

6313663

35084

50

17

843

88%

Alignment

FTCD

TTTGGTGCAAGGTACAGATATCTCCTTATG

GAAAATGTAATCAAGGGACAGGAAGGAAAC

68°C

28

4

0.607

980-1330 bp

1

CEB253

 

35145

45

14

629

97%

Alignment

LSS

ACTCAGGCAGTTAGGGGTACACATCCTAT

CAGACTTAAATTCTCCCTTAAATTCACAAA

62°C

28

6

0.490

875-1100 bp

1

CEB289

 

34741

45

45

2030

75%

Alignment

ATTGCACTGTGGTTATCTGGATGTTGTTTT

AATTACTTATATTCCGGCCCATCTGTGTGT

68°C

28

1

0

5000 bp

1

CEB247

 

34282

19

27

522

84%

Alignment

GTCACCTTCGTGTTTTCTGCCATCAG

CCCAGGGTTATAGGACAATTTTGAACCTG

68°C

28

1

0

650 bp

1

CEB254

6313664

35165

24

20

483

80%

Alignment

LSS

ATAAACTAGGTTTTCTTGGAGCAGCAGGAG

AAACTTAAACGAACCGTGTTAATATGTCCA

68°C

28

3

0.203

630-680 bp

1

CEB284

6313651

33832

21

55

1164

86%

Alignment

ACTAAAGCAGTACTGGCTCCCTCCCCTCT

AATCCTAGGTGCATTTCCGTAAACGGTGGT

68°C

28

3

0.554

1300-1340 bp

1

CEB283

6313650

33711

17

55

936

80%

Alignment

AGAACTCTTCTGGTTTCCCGCTGCT

GAAGAGAACTTTCAGATCAGAGCACGAGTT

68°C

28

4

0.708

1020-1100 bp

1

CEB282

6313649

33481

20

21

416

77%

Alignment

AGAGGTGATGAGCACAGGTGGTGAGAG

AGCATAACACATTCTGTTCTTTGGGCATTA

57°C

28

3

0.225

610-710 bp

1

CEB245

6313648

33383

52

12

631

88%

Alignment

TRPC7

TCTGTGGATAAACGTGAATATGCCCGAAAT

CCCAGAATCCCATTCCTGCCCAATG

68°C

28

2

0.035

850-900 bp

1

CEB244

6313647

33318

36

10

376

97%

Alignment

TRPC7

CTGCTGTAACCCAGGCTCACAAACCT

ACCCTAGATGACCCTAGTGGGACCTACAC

68°C

28

2

0.168

640-860 bp

1

CEB243

6313646

33317

60

11

653

93%

Alignment

TRPC7

CCCTAGGGAGGGGAGCCTAAGACCA

ATACCAGAGTCCAGCCAAGTTAGCCGTTT

68°C

28

3

0.275

410-770 bp

1

CEB281

6313645

33286

35

11

393

83%

Alignment

C21orf2

GCTCAGTTCTCTCTCCTATTCGACTTGGTC

ATGAAGCTGACGCGGAAGATGGTTCT

68°C

28

3

0.374

600-670 bp

1

CEB280

6313644

33109

19

22

422

80%

Alignment

CTGTGAACATTTTGTAGCCATGTTGTGTTA

AAAGAAGAAAAGAAAAGCAGGGCTCATACC

68°C

28

2

0.071

590-670 bp

1

CEB242

6313643

32690

51

12

594

93%

Alignment

LOC85572

TTCATTCCTGTGAAGCACAGCGTTT

AGAAAACAGGAGACTCACCACGATCAACT

68°C

28

7

0.657

650-1200 bp

1

CEB241

6313642

32529

20

122

2432

86%

Alignment

HSF2BP

AGAGCACACACCCACCACTAAAATCACTG

AGTGCATGGACTGCAGATATTGGGACT

54°C

28

4

0.569

1980-2550 bp

1

CEB279

 

32246

34

18

617

76%

Alignment

CTTCAGGAGGCTCTGTCTCTGGGTAGAAG

AGAGTGTGTGTGCACAACTGTCAGTGAA

68°C

28

1

0

761 bp

1

CEB285

6313653

34327

36

25

895

86%

Alignment

AACAGAAGCTCCTGCTGATGAATAATTTCC

GTTTAGAGAGAGGAATGGACGCAGAGTGTC

59°C

28

6

0.298

880-1090 bp

1

60 TR


Link to the tandem repeats data base main page