67 minisatellites studied on chromosome 22:
Click on a minisatellite name to view allele size and frequency data



28

70%

Repeat name

dbSNP ss#

Physical position (kb)

Unit length

Copy number

Total length

Percent matches

Sequence

Associated gene

left primer

right primer

PCR conditions (AT)

nbr of typed strains

nbr of alleles

Polymorphism index

Copy number range

Estimation mode

CEB224

6313665

1528

41

21

855

91%

Alignment

IL17R

CTAGCCTTACCCATCCCAACTAGCCTTACC

CAAGGAATCCTGACTGGTAGTGGTGCT

68°C

28

6

0.753

940-1500 bp

1

CEB213

1571

62

25

1548

94%

Alignment

CECR5

CTACTTCCCCTGCTTAGGAGCTTAGCCATC

GACTTATGAATCAATCAAGGGCTTGTGCTG

68 °C

28

5

0.526

900-1700 bp

1

CEB293

6313666

3522

36

20

719

86%

Alignment

CCCATGTATGTGTGCATTTCTCTATCCATT

CTGACACTCCATCAGTAGGATGGACACTG

64°C

28

3

0.349

825-905 bp

1

CEB208

3635

20

149

2987

77%

Alignment

GGGAAGGCATGAGAGAGATGCTAAGTGATA

ATCAGGAAACCCAACCCTTGAAATGCTCTT

28

failed

failed

failed

1

CEB225

6313667

4095

19

24

459

77%

Alignment

TCTTCTCATTACAAAAGAAGCATGTTCAAA

AACTCCAGGAAACTGGCAAGTCAGTCAG

59°C

28

2

0.226

555-595 bp

1

CEB216

6313668

10395

23

59

1362

79%

Alignment

GTTTCCCAATGCAAGTGTTTTGGTTTATTT

GGAGACTAACAGTGGCTACGGGATGTGTTA

60°C

28

2

0.069

1300-1600bp

1

CEB294

6313669

11741

43

12

506

73%

Alignment

ACACTTACCTCCATAGTGTGTGGCTGTGT

GAGGATGACCATGGGTATAATGCACAA

68°C

28

3

0.497

630-800 bp

1

CEB226

12766

21

26

521

79%

Alignment

AGCCCAGAGGTTCAAGGCTACGATTAG

CACCCCGGCTGTGTGTGTAACCTCT

68°C

28

1

0

650 bp

1

CEB295

13055

29

23

681

87%

Alignment

KREMEN

ACCAATGTAATCACAGGGTCCTTAGAGAGG

GAGAATCCATTCCTTGCCTTTTCAACCT

68°C

28

9

0.803

1020-4700 bp

1

CEB222

15802

23

26

587

84%

Alignment

KIAA0645

AGCTTTTTCTACCACAGATACCCTCACCTG

AAGGGCCCCCAAGTCACTGGAATACAT

60°C

28

1

0

1200 bp

1

CEB296

16228

21

83

1735

72%

Alignment

GGACATGCTTGAGGGAATTTTTACTTTGTC

AGAGGCTCTCCCAGAGCACCTACAAT

68°C

28

5

0.517

1860-2200 bp

1

CEB227

16333

37

14

515

82%

Alignment

CCCAAGGTCACACAGGATGTTATATTTCTT

AAAGTGAGGACAGTAACACAAGGCTTATCG

68°C

28

1

0

670 bp

1

CEB297

6313671

16658

21

28

602

85%

Alignment

ACCTGCCTGATTCCTACATTCCTACCAC

TCAGTAATTGTTTGCTTCTCCTCTCCTTCA

60°C

28

2

0.245

738-880 bp

1

CEB298

18295

20

20

395

86%

Alignment

ATTAAGATACAGACAAAAGCAGGGATGCTG

TAATCTTAGTTCACCCAGACATGCCCTAAG

68°C

28

8

0.782

1080-1300 bp

1

CEB299

6313672

19972

22

28

621

86%

Alignment

CAACTCAGTCTCATTCCCACTCTGAGATTT

TCCCATTTCCTACTTTAGAAACTTTGCGATT

68°C

28

8

0.795

1020-2500 bp

1

CEB228

20986

18

33

588

80%

Alignment

GGGAACAACAATTATCACCAGAGCCTAATA

CTGAAGAGTTGTGTGCAAGGATGCTCT

68°C

28

1

0

700-720 bp

1

CEB300

21044

18

47

851

80%

Alignment

RAC2

AGATGGACAGGAGAGCCAAGGCCTAAGT

GACACAGCCTCCAGGTGACCCCACT

68°C

3

0.564

1420-1670 bp

1

CEB201

6313673

21327

59

11

668

78%

Alignment

CARD10

ATCCCTGGTTCTGAAATCCTCAGCTTC

AAGGAGAAGGAGCCAGACAATGTGGAC

68°C

28

3

0.584

320-900 bp

1

CEB301

6313674

21541

147

12

1752

88%

Alignment

CTCAGGCTGCCTCTACACGTGAAATC

GTTGTCTCGTTGAAAGGAAAAGGACTGTGT

60°C

28

3

0.327

1650-2090 bp

1

CEB214

22157

25

19

480

91%

Alignment

GAGAGGTCAGCTATCAGGCCCATCC

GCTCCTGCCACCATGTCCATCTAAT

58°C

28

1

0

660 bp

1

CEB302

6313675

22447

57

10

552

97%

Alignment

AAGTAAGGACTGAAAGGTCAGCATTCTTGC

CTCCTTACGAGTGGATGAGGCTCGTTTAT

68°C

28

2

0.035

680-740 bp

1

CEB303

6313676

23529

30

15

455

81%

Alignment

GAAGCAAGAAACAGAGGGATTTAGGATTCA

CTTCTGCATCCTCTGCACCCAGCAT

60°C

28

2

0.133

710-770 bp

1

CEB304

25144

29

12

356

87%

Alignment

KIAA1031

GCCCTGCCCTAGATGAAGTAAGTTAGAATC

ACAGGATCTCATGAACCTGAGTCAGTGG

68°C

28

1

0

533 bp

1

CEB229

6313677

26130

22

16

353

88%

Alignment

AGAGACGAATAAACCAGTGAGGGTAAAAGG

TGTAAAAGGACATTAGCAAACCACACGATT

68°C

28

2

0.5

500-520 bp

1

CEB305

6313678

27086

47

28

1313

76%

Alignment

CCACCGAAACTTAAATATTCCCCACCTATG

GTCAGCCATGAGGAGAAGGAGAATGAG

68°C

28

14

0.889

1060-2150 bp

1

CEB306

27209

20

21

426

74%

Alignment

CAGGTAGATGTTCCCAAAGGTAGAACAGGT

CTAAAACGGAAGCCATTATCCAATGGTGAG

68°C

28

1

0

629 bp

1

CEB307

6313679

27382

26

15

401

85%

Alignment

FLJ23588

CAGCTTCAGAATCTAAACCCCTGGTTCTAA

CTGAGCAGAGCCAAGGACAATAATAGAGAC

68°C

28

4

0.581

430-640 bp

1

CEB217

27398

20

68

1364

82%

Alignment

FLJ23588

CTCTGCAGAAAGCATCTTCCCTTCTTGA

TACAGCTTCCATCTGCGTGGTGCTTTAGAC

68°C

28

1

0

1530 bp

1

CEB308

6313680

27654

28

33

918

91%

Alignment

SULT4A1

AGTAGCCTCAGTAAATCGAGGAACTCTCCA

CTTAACTGACGCCTTGCTCTCTGTCGTAT

63°C

28

7

0.781

600-1200 bp

1

CEB309

27773

35

11

387

80%

Alignment

CTCCAAAACCAAAAATCTCTATGACCCAAT

CAAAGTCACATGCTTTACCCTCAAACAAAG

58°C

28

1

0

513 bp

1

CEB212

6313681

28490

36

29

1037

88%

Alignment

CCCCAGCTGACCTACCTTGATCACTAT

TATAGTTGGGTTTAGGCCCACCATCTGTTA

68°C

28

4

0.487

1100-1400 bp

1

CEB202

6313682

29067

41

18

703

82%

Alignment

AGAAGCGGCTCAGCAAATTACAGTGTGAAC

ACTTTTCATCCCTCGCACCAGCTCAG

60°C

28

19

0.922

630-1900 bp

1

CEB230

30257

35

15

513

71%

Alignment

CELSR1

GTGTGTACGAGGCTGAGATCTAGGGATG

CGTGCCTCCACTGGTACTTGACACC

68°C

28

5

0.772

720-1200 bp

1

CEB231

6313683

30336

20

88

1761

84%

Alignment

GAGTGTGCACTGAACCCATTCTTTTATCAG

GTTCTGGCTTCTGAGGGTAACTGGTTATG

68°C

28

3

0.448

1620-1850 bp

1

CEB209

30404

46

16

755

90%

Alignment

KIAA0767

AAAATGTCCAGCACGCTTTTGAACTAGAGA

CTTCTTTCAGATATGGACCCTGGCGTGTTT

failed

28

failed

failed

failed

1

CEB310

6313684

30541

24

25

595

98%

Alignment

LOC150386

CCTTTTTATGGCTAAGTAGTATTCCATCGT

CGTTCAGGGAAAGAAAAACAGAGATGACTT

68°C

28

12

0.85

900-1550 bp

1

CEB311

6313685

30860

67

14

960

82%

Alignment

C22orf4

GTCTGGGTCGGTTGCAGTTGACAGTAG

CCAGCTGGATAAACTCTAAAGGTCTCAGGA

68°C

28

2

0.464

1115-1180 bp

1

CEB232

31534

17

22

373

Alignment

CTAAACCATTTGTCACCCTCTGGATTTGTT

CATAAGTGTGGAATTGTTGGTGGTTCTGAT

68°C

28

1

0

500-605 bp

1

CEB312

6313686

31865

19

23

439

81%

Alignment

AGACTCTGCCAGGTGGAAATTTAAGATTGG

GCCTGATATGCCAGAGGAGATGCTTAG

68°C

28

2

0.035

615-635 bp

1

CEB313

32217

40

17

685

79%

Alignment

ATGGTCAGCAAATAAACACCCCATGTATTT

GGCTGTTATCAGATTGTAGAGCAGAGCATC

64°C

28

1

0

811 bp

1

CEB314

6313687

32267

58

15

872

77%

Alignment

hypothetical protein

AGAAGCTTGAAAGACAAGACTGGAGTGTCC

TCTGAGCTCTTCCCAGGTATTCCACATATT

63°C

28

4

0.563

630-1040 bp

1

CEB203

32298

21

25

529

92%

Alignment

hypothetical protein

AACCACCTTCACATTTGAGAACTCGCTCTG

ACACACCCAACCCATCATCCTGTCTCTAT

68°C

28

1

0

700 bp

1

CEB315

32458

23

43

996

80%

Alignment

hypothetical protein

AAAGACCTCAGGGTGTAAGGACAGAAGAAA

TAGGCCATCCTAAAGGAAGGGACAGAG

68°C

28

5

0.715

1400-1600 bp

1

CEB218

32693

34

12

418

88%

Alignment

ACCCACACAGCCTCCGTGAATTATTTAGTA

AACCTACAAGAGCACTTGGAAACCGAAG

68°C

28

1

0

600 bp

1

CEB316

6313688

32741

18

33

592

78%

Alignment

ACAAAGAGTGGACCCTGAATCACAATGAAT

AAAAATTTCCGCTGTTTAAGCTGCCTGGAC

68°C

28

5

0.616

705-805 bp

1

CEB219

6313689

32911

30

14

411

92%

Alignment

ACACTGAACATTGGGAAGGGCTTCTTCTAC

CCTGTGGCTTCTTCCTGTCTCAGGTAAC

68°C

28

3

0.510

500-700 bp

1

CEB317

32915

26

19

489

81%

Alignment

ACCTTCAATATCCGTTCACCCTCTGTATCT

AAAAAGTGCTGGGAAAAGCCCTCATCT

68°C

28

1

0

594 bp

1

CEB204

6313690

32948

32

21

671

82%

Alignment

CAGTTCCTCAAACCCCAAGTGAAGATGA

CAGGATACTAGGGCCTAAGCAGTTTGGACA

68°C

28

5

0.661

850-1500 bp

1

CEB318

6313691

32980

43

13

559

90%

Alignment

CACTATCACAAGAACAGCACGGGAAAACCT

CACATGTGAGGCTGCATGGGAAGAAC

68°C

28

3

0.433

735-860 bp

1

CEB205

6313692

33057

33

33

1086

96%

Alignment

LOC129238

GCGTTTAGAAAGACAGGTGCAAGAATTAGG

AGTGGTTGAGCGTCTCCTTCTGTCTCAAT

68°C

28

19

0.932

550-2500 bp

1

CEB206

6313693

33318

45

22

1024

88%

Alignment

AGAACACAGCAGCTGAAATGCCATACC

CCTAACAAAGAAAGGTCAGAGTGAGCTGTG

68°C

28

2

0.435

820-1270 bp

1

CEB233

33400

45

16

736

82%

Alignment

TGCTAGGAAATCCTTGTCTGCTGTGTATAA

CAGCACATGGCATTTGTTAGGATACACATA

68°C

28

1

0

850 bp

1

CEB319

33414

38

11

420

93%

Alignment

ACTCTCCCTCCCATCCTCCACTCTC

CTGCTGTTGCTTCTGCTCTCAGTTCATA

68°C

28

1

0

572 bp

1

CEB320

6313694

33419

32

18

563

91%

Alignment

CTCCTCTCAGACCCTGTCACAGAACAAAC

GCTCATGAGAAAACAGTAGATCCATCTGAG

68°C

28

2

0.035

691-755 bp

1

CEB321

6313695

33434

31

38

1172

77%

Alignment

GAAGAGACCTCATCATGGGCAGTCC

ATCCTCTACTAGCCCTGATAGCACCACATC

63°C

28

5

0.624

1240-1500 bp

1

CEB322

6313696

33545

33

11

359

91%

Alignment

CCTCACTGCTCATTGGCATCAGACAT

GGTACTGCTTCTTGAGGACAGGGCTAACT

68°C

28

2

0.035

545-578 bp

1

CEB220

6313697

33592

47

13

611

98%

Alignment

BRD1

AAGACCCAAGATCTGAACCCTCAACTTCCT

GTGACTTGGCTTTCCATCTCTCCTCTGT

68°C

28

3

0.283

700-925 bp

1

CEB323

33618

37

19

702

71%

Alignment

ATGGAGAGTGGGGGCCCTTGAGTTAG

CTTTTCTTGCAACCTTAAAGGGCATCTG

68°C

28

1

0

872 bp

1

CEB207

6313698

33817

19

129

2459

76%

Alignment

ACAACACAATAAACAAATCTGGCCCAACTC

AGGAGTTTCTTAACTGTGACAGGGGATGCT

68°C

28

2

0.133

2600-3500 bp

1

CEB324

6313699

33825

43

21

890

93%

Alignment

GTGGGGCAAGAGGCATCTCCGTGAGT

CGCCCGGCAATAGGGGGGGTCTTTA

68°C

28

19

0.927

400-3500 bp

1

CEB325

6313700

33854

18

42

751

81%

Alignment

GCCCCTTCCTCTCTGGTTCCATACTG

CTCTGCCTTCAGAACCCCATACCTCT

58°C

28

4

0.528

930-1400 bp

1

CEB221

6313701

33864

23

27

625

91%

Alignment

MLC1

CAAAATAATTGGAGTAGGAGTGGGTGAAGC

AAGTGGTTTTGCACCCAAATCATTAGAAGA

68°C

28

3

0.513

755-825bp

1

CEB326

6313702

33965

75

16

1224

83%

Alignment

AAAGCAGAAAGTGCATCTGGAAAACAAAG

TAAAGATCCTTGCATGTTTTCTGAGGGATG

68°C

28

3

0.253

1250-1675 bp

1

CEB327

33983

52

10

543

74%

Alignment

PP2447

CAGGAGGCGCGTGGGACTACACTT

GGCCGCCTTCCTCCACTCTCACCT

68°C

28

1

0

793 bp

1

CEB223

6313703

34031

27

54

1456

75%

Alignment

GCP6

AATACCAGCACGATCGATTCTATCAGGACA

CCCTGTGGAGACAGTGTTTTGTGATG

68°C

28

2

0.499

1850-1950 bp

1

CEB210

34182

62

28

1732

93%

Alignment

KIAA0685

TCTGTAAAATGGAGTGAGAGCAGTGTCTGTTT

AGACCCACGACCCAGAGAGCCAAGTG

failed

28

failed

failed

failed

1

CEB211

34393

43

17

695

95%

Alignment

CTGATTGGTTGGGTTGGAGACAAAATCAT

CCTCCATGGGCGCAGGTTGAACTAA

failed

28

failed

failed

failed

1

67 TR


Link to the tandem repeats data base main page